Basque haplogroup

A rare haplogroup, HV14 has been previously reported from Iran ... F. & Bertranpetit, J. A genome-wide survey does not show the genetic distinctiveness of basques. Hum. genetics 127, 455–458 ...

The Basque Diaspora in Western USA and Argentina represents two populations which have maintained strong Basque cultural and social roots in a completely different geographic context. Hence, they provide an exceptional opportunity to study the maternal genetic legacy from the ancestral Basque population and assess the degree of genetic introgression …Abstract. The European paternal lineage R-DF27 has been proposed as a haplogroup of Iberian origin due to its maximum frequencies in the Iberian Peninsula. In this study, the distribution and structure of DF27 were characterized in 591 unrelated male individuals from four key populations of the north area of the Iberian Peninsula through the ...Six major haplogroups (R, I, E, J, G, and DE) were detected, being R-S116 (P312) haplogroup the most abundant at 75.0% in Alava, 86.7% in Guipuzcoa and 87.3% in Vizcaya. Age estimates for the...DNA from ancient remains seems to have solved the puzzle of one of Europe's most enigmatic people: the Basques. The distinct language and genetic make-up of the Basque people in northern Spain...Haplogroup H is a human mitochondrial DNA (mtDNA) haplogroup. The clade is believed to have originated in Southwest Asia , near present day Syria, [1] around 20,000 to 25,000 years ago. Mitochondrial haplogroup H is today predominantly found in Europe, and is believed to have evolved before the Last Glacial Maximum (LGM).

E-V22/YF66572. mtDNA haplogroup. J1c5c1. Dec 14, 2011. #3. spongetaro. J1c is found at 10% among Basque people. When you look at this distribution map, it looks like the dark areas show the oldest form of R1b (L23, M173) in western Eurasia. There is also a medium dark area around Austria.Haplogroup R1b1a-S116*, which has its greatest frequency in Iberia was, by far, the most frequent haplogroup observed in our sample, representing 32.5% of the Y chromosomes investigated [34,35]. Other R1b1a-M269 sub-lineages, more prevalent in other parts of Europe were also detected, including R1b1a-L23*, R1b1a-U106, R1b1a-U152 and …Barscunes coin, Roman period. The English word Basque may be pronounced / bɑːsk / or / bæsk / and derives from the French Basque ( French: [bask] ), itself derived from Gascon Basco (pronounced [ˈbasku] ), cognate with Spanish Vasco (pronounced [ˈbasko] ). Those, in turn, come from Latin Vascō (pronounced [ˈwaskoː]; plural Vascōnēs ...The mtDNA haplogroup composition of the French does not differ significantly from the surrounding European genetic landscape. At a finer grain, microgeographical differentiation can be revealed, as shown for the French Basque country and for Brittany.Haplogroup U is a human mitochondrial DNA haplogroup (mtDNA). The clade arose from haplogroup R, likely during the early Upper Paleolithic.Its various subclades (labelled U1–U9, diverging over the course of the Upper Paleolithic) are found widely distributed across Northern and Eastern Europe, Central, Western and South Asia, as well as North Africa, the Horn of Africa, and the Canary Islands. Basque people belong to this Haplogroup and they were among the earliest settlers of the Iberian Peninsula. 73% of modern day Basque share this origin. The following markers are common to the people bordering Europe's Atlantic within a couple of steps; DYS19 (DYS394)=14, DYS388=12, DYS390=24, DYS391=11, DYS392=13 and DYS393=13.The rare variety R1b1c4 (R1b1b2a2c) has almost always been found among the Basque people, both in the Northern and Southern Basque Country. The variety R1b1c6 (R1b1b2a2d) registers a high incidence in the Basque population, 19%. The Y-DNA haplogroup R1b (R-M269) (R1b1a2) is also prominent among the Bashkirs of the Volga …

Haplogroup H dominates present-day Western European mitochondrial DNA variability (>40%), yet was less common (~19%) among Early Neolithic farmers (~5450 BC) and virtually absent in Mesolithic ...The European paternal lineage R-DF27 has been proposed as a haplogroup of Iberian origin due to its maximum frequencies in the Iberian Peninsula. In this study, the distribution and structure of DF27 were characterized in 591 unrelated male individuals from four key populations of the north area of the Iberian Peninsula through the analysis of ...The R1b Y-chromosome haplogroup in Iberia is mainly represented by the R-S116 haplogroup, which reaches 80% in the Basque Country (average of all Basque Provinces) 42. A derivative lineage of S116, DF27, which likely originated in Iberia reaches a maximum value of 63% in the Basque Country and minimum value of 40% in Galicia 12.Table-1 showing the regions where the Haplogroup samples came from show that for the Basques only 8 mt-DNA were fully sequenced, all of them belonging to haplogroup H, they in turn reference it to the work of Alvarez-Iglesias et al(2009). Here is an excerpt from the Alvarez-Iglesias et al(2009) study:... haplogroup H.We identified six mtDNA haplogroups, H1j1, H1t1, H2a5a1, H1av1, H3c2a ... We thus characterize the maternal ancestry of 908 Basque and non-Basque ...From the evolutionary perspective, the high frequency of haplogroup H found in the population of San Miguel de Ereñozar (Basque Country, Spain) could be considered as a result of a biological ...

How does fossil containing limestone form.

The evidence of mtDNA haplogroup F in a European population and its ethnohistoric implications. 2001 • Igor Rudan. Download Free PDF View PDF. The American Journal of Human Genetics. The Molecular Dissection of mtDNA Haplogroup H Confirms That the Franco-Cantabrian Glacial Refuge Was a Major Source for the European Gene Pool.MtDNA haplogroup classification of further 62 samples was based on multiplex typing of single ... Ancient genomes link early farmers from Atapuerca in Spain to modern-day Basques. Proc. Natl. Acad.23 Mar 2014 ... ... basque espagnol en passant par l'Irlande et la façade atlantique de ... haplogroup i2 nordique balkans haplogroup r1a Europe de l'est.A pre-M269 but non-M73 male, i.e. leading from P297 towards M269 ancestor was found in Samara culture on the Volga River living around 5500 BC. It was also confirmed that the Kurgan-building Yamnaya steppe herders and their eastern offshoot Afanasievo culture (probably proto-Tocharian) belonged predominantly to Haplogroup R1b-Z2103.Haplogroup R1b ( R-M343 ), previously known as Hg1 and Eu18, is a human Y-chromosome haplogroup . It is the most frequently occurring paternal lineage in Western Europe, as well as some parts of Russia (e.g. the Bashkirs) and across the Sahel in Central Africa, namely: Cameroon, Chad, Guinea Mauritania, Mali, Niger, Nigeria and Senegal ...

Mar 10, 2021 · The R1b Y-chromosome haplogroup in Iberia is mainly represented by the R-S116 haplogroup, which reaches 80% in the Basque Country (average of all Basque Provinces) 42. A derivative lineage of S116, DF27, which likely originated in Iberia reaches a maximum value of 63% in the Basque Country and minimum value of 40% in Galicia 12. The mtDNA haplogroup came back as T2b, which is common in England, Iceland, and Scandinavia. Her strontium isotopes values, however, suggest early mobility. Between the time her first molar ...Haplogroup R1b (R-M343), previously known as Hg1 and Eu18, is a human Y-chromosome haplogroup.. It is the most frequently occurring paternal lineage in Western Europe, as well as some parts of Russia (e.g. the Bashkirs) and across the Sahel in Central Africa, namely: Cameroon, Chad, Guinea Mauritania, Mali, Niger, Nigeria and Senegal (concentrated in parts of Chad with concentration in the ... A pre-M269 but non-M73 male, i.e. leading from P297 towards M269 ancestor was found in Samara culture on the Volga River living around 5500 BC. It was also confirmed that the Kurgan-building Yamnaya steppe herders and their eastern offshoot Afanasievo culture (probably proto-Tocharian) belonged predominantly to Haplogroup R1b-Z2103.A sample of 416 males from western and eastern Andalusia has been jointly analyzed for surnames and Y-chromosome haplogroups and haplotypes. The observed number of different surnames was 222 (353 when the second surname of the Spanish system of naming is considered). The great majority of recorded surnames have a Castilian-Leonese origin, while Catalan or Basque surnames have not been found. A ...During the Middle Neolithic there was a largely male-driven resurgence of WHG ancestry among many EEF-derived communities, leading to increasing frequencies of the hunter-gatherer paternal haplogroups among them. The Y-DNA of EEFs was typically types of haplogroup G2a, and to a lesser extent H, T, J, C1a2 and E1b1, while their mtDNA was …DF27 haplogroup seems to have a geographical significance in the Iberian Peninsula. The TMRCAs suggest DF27 is a young lineage that arose 4176 ± 696 years ago. DF27 could be used to trace Iberian male migrations into the Americas. DF27 could be used to trace the biogeographic paternal origin of a forensic evidence.HLA DR3-DQ2 is double serotype that specifically recognizes cells from individuals who carry a multigene HLA DR, DQ haplotype. Certain HLA DR and DQ genes have known involvement in autoimmune diseases. DR3 - DQ2, a multigene haplotype, stands out in prominence because it is a factor in several prominent diseases, namely coeliac disease and ...Tweet. #5. 26 June 2012, 10:25 AM. Seeing as how the maternal haplogroup came from your most distant female direct ancestor it absolutely could have been Jewish. People convert all the time and many Jews converted out of pressure of banishment or death. Coming from a place like Galicia I would not doubt this is the case.• R1b1a2a1a (L11/S127, L52, L151, P310/S129, P311/S128) Common father of the German and Celtic R1 haplogroup in Europe. 2.3 The Basque are only in the Iberian Peninsula In opposition to the hypothesis of Oppenheimer, the Basque genomic group, which includes the “M153 T->A 427 ttactgataatgccatattgttttg ttctcagacaccaatggtcct” (R1b1c4 aka ...

Figure 21. Y haplogroups in the Spanish Basque Provinces 114 Figure 22. Skeleton median-joining network of R1b haplotypes in the four Basque Provinces 116 Figure 23. mtDNA haplogroups among Basques 118 Figure 24. Network of Basque Haplogroup H sequences 125 Figure 25. Comparison of p values from the exact test of HWE for corrected

The mtDNA haplogroup came back as T2b, which is common in England, Iceland, and Scandinavia. Her strontium isotopes values, however, suggest early mobility. Between the time her first molar ...Modern DNA research into male Y chromosomes has found that the R1b haplogroup reaches very high concentrations in Western Ireland and the Basque country in northern Spain. While the picture for matrilineal descent (mother to daughter) is more complex, it seems that the northern Spanish and the Irish might have common male ancestors at some ...Each haplogroup corresponds to a distinct ancestral lineage. ... The autosomal data provided by Haak et al 2015 (extended data figure) shows that the Sardinians only differ from the Basques by the presence of Bedouin-like (purple) and Caucaso-Gedrosian (greyish green) admixture, and a slightly more elevated percentage of Neolithic farmer ...The majority (about 86%) of the Basque Y chromosomes belong to haplogroup R1 * (xR1a,R1b3f)-M173, of which R1b3 * -M269 accounts for 88% ( Figure …Basque and Celtic people belong to this Haplogroup and they were among the earliest settlers of the Iberian Peninsula. 65% of modern day Iberians share this origin. The following markers are common to the people bordering Europe's Atlantic within a couple of steps; DYS19 (DYS394)=14, DYS388=12, DYS390=24, DYS391=11, DYS392=13 and …5 Jun 2012 ... ... haplogroups, may have spoken a language ancestral to modern Basque, i.e. "Ancient Basque." Haplogroup E Among Basque People. 93.8% of those ...Maternal Haplogroup K2b1a1a (mtDNA) is pretty rare. Let’s form our own tribe! Join only if you personally share this haplogroup. Summary of K2b1a1a...We know from at least the 1st millennium BC these non-Indo-European people lived in different parts of Europe, what was the main haplogroup among them?The rare variety R1b1c4 (R1b1b2a2c) has almost always been found among the Basque people, both in the Northern and Southern Basque Country. The variety R1b1c6 (R1b1b2a2d) registers a high incidence in the Basque population, 19%. The Y-DNA haplogroup R1b (R-M269) (R1b1a2) is also prominent among the Bashkirs of the Volga …

Sonic fnf sprites.

Parker braun basketball.

Genetic studies on Y-DNA haplogroups have revealed that the dominant frequency for Bashkir males is the haplogroup R1b (R-M269 and R-M73) which is, on average, 47.6%. The second most dominant haplogroup is haplogroup R1a at an average frequency of 26,5%, and the third is haplogroup N1c at 17%.The age of subclade which Basque carry, Haplogroup R1b-DF27, "is estimated at ~4,200 years ago, at the transition between the Neolithic and the Bronze Age, when the Y chromosome landscape of Western Europe was thoroughly remodeled.... Haplogroup R0. ... In addition, we have characterized, by way of complete genome sequencing, a new autochthonous clade of haplogroup H in the Basque country, ...During the Middle Neolithic there was a largely male-driven resurgence of WHG ancestry among many EEF-derived communities, leading to increasing frequencies of the hunter-gatherer paternal haplogroups among them. The Y-DNA of EEFs was typically types of haplogroup G2a, and to a lesser extent H, T, J, C1a2 and E1b1, while their mtDNA was …Table-1 showing the regions where the Haplogroup samples came from show that for the Basques only 8 mt-DNA were fully sequenced, all of them belonging to haplogroup H, they in turn reference it to the work of Alvarez-Iglesias et al(2009). Here is an excerpt from the Alvarez-Iglesias et al(2009) study:Download scientific diagram | Geographic maps of haplogroup frequencies for haplogroups H*, H1, H2a, H3, H4, H5a, H6a, H7, H8, H11. Dots in the map of H* indicate the location of the populations used.To this end, we characterized the maternal ancestry of Basque- and non-Basque-speaking populations from the Franco-Cantabrian region and, by sequencing complete mtDNA genomes, we focused on haplogroup H—the most dominant haplogroup in Europeans and in Basques in particular (∼45%).13,14,34,36 In contrast to genome-wide analysis and Y ...... haplogroup H.We identified six mtDNA haplogroups, H1j1, H1t1, H2a5a1, H1av1, H3c2a ... We thus characterize the maternal ancestry of 908 Basque and non-Basque ...That is, 90% of modern Basque speakers can trace their paternal ancestry to North-West Indo-European-speaking Yamna settlers in Hungary ca. 2900-2600 BC. David Reich and Iosif Lazaridis have confirmed the role of R1b-L23 subclades in the expansion of East Bell Beakers to Iberia, however small their share of “steppe ancestry” actually is.Feb 6, 2018 · The PCA of haplogroup frequencies of Kow-OVIA-F/M and 73 extant worldwide populations again revealed high genetic differences between Kow-OVIA-F and Kow-OVIA-M (Supplementary Fig. S3b and Table ... ….

The R1b Y-chromosome haplogroup in Iberia is mainly represented by the R-S116 haplogroup, which reaches 80% in the Basque Country (average of all Basque Provinces) 42. A derivative lineage of S116, DF27, which likely originated in Iberia reaches a maximum value of 63% in the Basque Country and minimum value of 40% in Galicia 12.There seems to have been a movement, though, rather late possibly around the 5th century AD of people with more East Asian admixture than Khanty and Mansi people and high in haplogroup N. The Greek sources (Theophylact) point to a region close to or around Ufa (from Kara Itil/Atel) for the origins of Pannonian Avars (pseudo-Avars, …Working with ancient DNA is an extremely useful approach in prehistoric population genetics. In this work we observed that all the samples already analysed belonged to haplogroup H of the mtDNA. Thus, we aimed to check the frequency of haplogroup H in samples from the Basque Country to assess the possibility of using it as a genetic …Nov 1, 2014 · A similar process seems to have occurred in the Basque population, with a large percentage of the Basque U5 mtDNA falling into a relatively young subclade U5b1f1a. In a 2012 study of the Basque by Behar et al., haplogroup U5 represented approximately 18% of the Basque population. However, about two-thirds of these were in U5b1f1a. Moreover, the relatively high prevalence of R haplogroup R1b1a2 (R-M269) haplogroup in Sardinia (~18%) ... More recently the Basque have been shown to be enriched for Neolithic farmer ancestry 20,45 and Indo-European languages have been associated with Steppe population expansions in the post-Neolithic Bronze Age 18,23.Haplogroup I1b1b appears to be the only subclade of Haplogroup I found among the Basques, although subclades of Haplogroup R1b comprise the vast majority of that people's Y-chromosome diversity. It is notable that Haplogroup I1b1b appears to be found at somewhat higher frequencies among the general populations of Castile in Spain and …Mar 10, 2021 · Six major haplogroups (R, I, E, J, G, and DE) were detected, being R-S116 (P312) haplogroup the most abundant at 75.0% in Alava, 86.7% in Guipuzcoa and 87.3% in Vizcaya. Age estimates for the R-S116 mutation in the Basque Country are 3975 ± 303, 3680 ± 345 and 4553 ± 285 years for Alava, Guipuzcoa and Vizcaya, respectively. Pairwise Rst ... Haplogroup U is a human mitochondrial DNA haplogroup (mtDNA). ... Haplogroup U8a: The Basques have the most ancestral phylogeny in Europe for the mitochondrial haplogroup U8a. This is a rare subgroup of U8, placing the Basque origin of this lineage in the Upper Palaeolithic. The lack of U8a lineages in Africa suggests that their ancestors … Basque haplogroup, Genetic studies on Sami is the genetic research that have been carried out on the Sami people. The Sami languages belong to the Uralic languages family of Eurasia. Siberian origins are still visible in the Sámi, Finns and other populations of the Finno-Ugric language family. [1], The RFLP anal- mtDNA data (e.g., Richards et al. 2000) and additional ysis described below was also performed on mtDNAs mtDNA coding-region information (Macaulay et al. that lacked 16298C but harbored 16256T, as suggested 1999) have become available, so that the variation of by the observation of this HVS-I motif in one Basque haplogroup V can ..., Dec 7, 2011 · The identity of the Basque and Berber is still evident. in the sixteenth century manuscripts of the Gauls colonial archives in Aix-en-Provence. written in Amazigh. The Romans described the vasconum as "men of various races," and hence. the Celts to the nickname they referred only to its location on the top and not a. , Haplogroup G2a (Y-DNA) The main paternal lineage of Neolithic farmers. Haplogroup J1 (Y-DNA) The dominant Arabic paternal lineage. Haplogroup R1b (Y-DNA) The dominant paternal lineage in Western Europe. MtDNA by country. Frequencies by regions in Europe and the Near East. The origins of red hair., However, excluding haplogroup H, mtDNA phylogeny of this area remains virtually unexplored, so we still lack an in-depth image of this interesting spot of Europe. For this reason, further characterization of the current Basque maternal gene pool is crucial for a better understanding of the genetic prehistory of southwestern Europe., Haplogroup R1b ( R-M343 ), previously known as Hg1 and Eu18, is a human Y-chromosome haplogroup . It is the most frequently occurring paternal lineage in Western Europe, as well as some parts of Russia (e.g. the Bashkirs) and across the Sahel in Central Africa, namely: Cameroon, Chad, Guinea Mauritania, Mali, Niger, Nigeria and Senegal ..., The U5b haplogroup is considered to be rare in modern populations - all of the reported carriers are of European ancestry and from Spain, Portugal, England, Ireland, Scotland, the US, and Germany. As professor Matisoo-Smith told Phys.org : “It is remarkably rare in modern populations today, found in Europe at levels of less than one per cent., Basque Y-DNA haplogroup R1b1b2a1a mtDNA haplogroup H4a1a1a. Jan 18, 2017 #2 Thanks so much Maciamo for the information and the H4 map. It is quite obvious that we H4s are few but all over the place. I agree with you that the present distribution of the haplogroup does not help much in determining its origins, and it might be due to scarcity of ..., Y-DNA haplogroup R-M207 is believed to have arisen approximately 27,000 years ago in Asia. The two currently defined subclades are R1 and R2. ... R-M153 The Basque Marker. Y-Haplogroup R SRY2627/L176.2/Z198, Gareth Henson, Stephen Parrish et al. R-L165 (S68) Project, Lori McLeod-Wilke, Alasdair Macdonald, Conrad Terrill, Timothy McLeod., Dec 31, 2019 · From the evolutionary perspective, the high frequency of haplogroup H found in the population of San Miguel de Ereñozar (Basque Country, Spain) could be considered as a result of a biological ... , Genetically, the Basques are outliers in the European distribution for several classical markers, including blood groups ABO, Rhesus, and MNS, erythrocytic enzyme adenylate kinase (AK), and immunoglobulin GM (Izagirre et al. 2001)., First, the haplogroup H dissection indicates that populations from the Basque Country and adjacent regions, rather than the Basque population per se, are characterized by numerous low-frequency autochthonous haplogroups, each explaining ∼2%–6% of the region's contemporary maternal ancestry, along with other H haplogroups that present a pan ..., Haplogroup I2a1 appears to be the only subclade of Haplogroup I found among the Basques, although subclades of Haplogroup R1b comprise the vast majority of that people's Y-chromosome diversity. It is notable that Haplogroup I2a1 appears to be found at somewhat higher frequencies among the general populations of Castile in Spain and …, language, the haplogroup diversity was lower for Basque. speakers (haplogroups P 5 0.0078, t 5 3.04, degree of free-dom [df] 5 16; mean number of pairwise differences P 5., Although an early study on the Basque population based on the phylogeny and phylogeography of haplogroup U8 has been published [13], no wide-scale studies for this haplogroup exist. Taking advantage of the impressive increase in mitochondrial sequences available today, here, I carried out a wide, spatiotemporal analysis of haplogroup U8 using past, Besides these two, the most common mtDNA lineages among Basques are H1, H3 and V. Among these, this paper finds that sublineages H1j1 and V10 are notably common in the country. Overall and based in an array of older papers, the authors feel that they must support the post-LGM recolonization theory, which would have originated from …, Basque people belong to this Haplogroup and they were among the earliest settlers of the Iberian Peninsula. 73% of modern day Basque share this origin. The following markers are common to the people bordering Europe's Atlantic within a couple of steps; DYS19 (DYS394)=14, DYS388=12, DYS390=24, DYS391=11, DYS392=13 and DYS393=13. , Mitochondrial DNA control region variation in an autochthonous Basque population sample from the Basque Country. ... haplogroup V as a marker for a major ..., This study examines the genetic variation in Basque Y chromosome lineages using data on 12 Y-short tandem repeat (STR) loci in a sample of 158 males from four Basque provinces of Spain (Alava, Vizcaya, Guipuzcoa, and Navarre). As reported in previous studies, the Basques are characterized by high frequencies of haplogroup …, Haplogroup I first appears in Europe with the arrival of Proto-Indo-European cultures, notably the Unetice culture associated with Y-haplogroup R1b. The absence of haplogroup I from Paleolithic, Mesolithic and Neolithic sites, and from modern non-Indo-European speaking populations such as the Saami, the Basques and the Maghrebians all play in ..., Aug 4, 2017 · Haplogroup R1b-M269 comprises most Western European Y chromosomes; of its main branches, R1b-DF27 is by far the least known, and it appears to be highly prevalent only in Iberia. We have genotyped ... , R-M153 is called the “Basque Marker” and is virtually nonexistent outside of the Basque Country or with non-Basques. 23andMe does not test for R-M153. On July 30th, we updated the paternal haplogroup algorithm to consider an expanded set of variants on the Y chromosome. As a result, certain customers on the v5 chip will observe updated ..., DNA from ancient remains seems to have solved the puzzle of one of Europe's most enigmatic people: the Basques. The distinct language and genetic make-up of the Basque people in northern Spain..., We would like to show you a description here but the site won’t allow us. , Haplogroup H is a human mitochondrial DNA (mtDNA) haplogroup. The clade is believed to have originated in Southwest Asia , near present day Syria, [1] around 20,000 to 25,000 years ago. Mitochondrial haplogroup H is today predominantly found in Europe, and is believed to have evolved before the Last Glacial Maximum (LGM)., This article was translated by John R. Bopp Paolo Virtuani in the Italian daily Il Corriere della Sera has just written that on Sardinia, the oldest DNA in Europe can be found, and it’s very similar to that of the …, May 23, 2006 · Furthermore, ancient DNA studies on Basque historic and prehistoric samples have detected important mtDNA haplogroup frequency fluctuations along different periods. Definitively, like other European populations, Basques have also suffered migration and genetic drift effects throughout its long history. , We would like to show you a description here but the site won’t allow us. , Haplogroup I first appears in Europe with the arrival of Proto-Indo-European cultures, notably the Unetice culture associated with Y-haplogroup R1b. The absence of haplogroup I from Paleolithic, Mesolithic and Neolithic sites, and from modern non-Indo-European speaking populations such as the Saami, the Basques and the Maghrebians all play in ..., With the development of DNA testing, many researchers have come to agree that the Basque people are descended from Neolithic farmers. These farmers were able to thrive in the rugged Basque region of the Pyrenees mountains. Interesting fact: Euskara, the Basque language spoken by at least 750,000 people, is the oldest language in the …, Jul 5, 2019 · I've found out I've inherited Haplogroup H, specifically H1, H1a, H1aV1, and H4. I've researched H1av1 and H4 apparently found in neothilic Spain specifically Basque region where my maternal lineage comes from (mum is o negative and irish ancestry, must have been from Basque movement into Ireland.) , Map of Romania showing the approximate migration routes and the mtDNA haplogroup distribution in the Romanian provinces. The map depicts the geographic distribution of mtDNA haplogroups in the Romanian provinces as reported in Additional file 2: Table S3: Wallachia (yellow), Dobrudja (blue), Moldavia (green) and Transylvania …, Haplogroup C reaches the highest frequency in northwestern Vietnam (Fig. 3c). Most (~84%) of the sequences belong to C7 and network analysis shows a star-like pattern, suggesting expansion (Fig. 3a,b). This haplogroup has a patchy distribution in AN groups from Taiwan and in Vietnamese individuals from all five language families.